rs9831224 chr3:115437134 G>A
- Sequence
tggaacctttctatcctggaaaag[G/A]tagtgattcatctcgactggaaaa
- ASB in cell types
- MCF10CA1a (breast metastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10CA1a (breast metastatic epithelial cells) | -5.27 | 3.09 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), serum creatinine, systolic blood pressure (sbp), total cholesterol change with statins, years of education