rs9860371 chr3:193970383 A>G
- Sequence
ggggagctctgcgggctgttgaac[A/G]tgtagaataggacctagttggaaa
- ASB in cell types
- T47D (invasive ductal carcinoma) fibroblast of pulmonary artery LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | n/a | 2.36 | 5.22 | |||
| fibroblast of pulmonary artery | 2.52 | n/a | 1.33 | |||
| LNCaP (prostate carcinoma) | -0.44 | 1.15 | 1.12 |
Items per page:
1 – 3 of 3