rs9877004 chr3:146219047 A>C
- Sequence
caagattcttaatttgagtcacag[A/C]gacaatttttgtcagtcttcgtaa
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) H929 (plasma cell myeloma) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.45 | 1.95 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins
GTEx eQTL Adrenal_Gland, Artery_Aorta, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis