rs9878341 chr3:14508992 C>T
- Sequence
aggacagaggggccaggcacacag[C/T]aggtgcccagtacatgctcgaatt
- ASB in cell types
- A549 (lung carcinoma) neutrophils GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.25 | 0.99 | 1.98 | |||
| neutrophils | 1.77 | -0.86 | 1.50 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -0.77 | 0.94 | 1.00 |
Items per page:
1 – 3 of 3