rs988959 chr2:42060249 C>T
- Sequence
aaatggaggtcccgcaaggcataa[C/T]atctttttagaaagactgacacac
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi) GM19239 (male B-cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.98 | 0.31 | 1.59 | n/a | No Hit | |||
| STAG1_HUMAN | 2.02 | 0.64 | 1.72 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, infant head circumference, obesity with early age of onset (age >2)
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung