rs9900378 chr17:35584283 C>T
- Sequence
tactttcttatgagttatctgcaa[C/T]tcctgtttttatttcctcatttct
- ASB in cell types
- monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.42 | 2.94 | 2.20 | 4.51 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, adiponectin levels, advanced age-related macular degeneration (geographic atrophy), college completion, ldl cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Colon_Transverse, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid