rs9906697 chr17:72004069 A>T
- Sequence
agacactgatgcacaatccttgtc[A/T]aagctgggcagcctctgtccactc
- ASB in cell types
- hTERT-HME1(Telomerase immortalized cell line)
- ASB for transcription factors
- BRCA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRCA2_HUMAN | -2.24 | 2.60 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid