rs9909321 chr17:1649493 C>T
- Sequence
gcagctcctgctccgccggctgcg[C/T]cgacacctgcagctggggagaccc
- ASB in cell types
- brain prefrontal cortex region tissues
- ASB for transcription factors
- OLIG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OLIG2_HUMAN | 2.21 | -1.89 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Substantia_nigra, Stomach, Thyroid