rs9920885 chr15:97875723 A>C
- Sequence
gccagagccggctccctctgctgg[A/C]ggggaggtgtggagggagaggcgc
- ASB in cell types
- HCT-116 (colon carcinoma) 22RV1 (prostate carcinoma) epithelial cell of prostate pancreas
- ASB for transcription factors
- CTCF_HUMAN ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.55 | 1.62 | 1.44 | 2.56 | Concordant | |||
| ZFX_HUMAN | 3.09 | -0.17 | 1.17 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
