rs9929488 chr16:56964660 G>C
- Sequence
ccccaggggtggtctctgctaccc[G/C]cgcacattgggccttgagtcttgg
- ASB in cell types
- neutrophils from periferal blood SH-SY5Y (neuroblastoma) CD14+ monocytes MDA-MB-435 (amelanotic melanoma)
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.41 | -4.33 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, hdl cholesterol change with statins, ldl cholesterol, total cholesterol, total cholesterol change with statins, triglycerides