rs9935212 chr16:22195800 C>T
- Sequence
cactcggccacgctacctcccgat[C/T]gtagggcttcctatgccggcatat
- ASB in cell types
- macrophages primary B-CLL cells MRC-5 (fetal lung fibroblasts)
- ASB for transcription factors
- CEBPB_HUMAN BRD4_HUMAN SOX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 2.83 | -0.50 | 2.12 | n/a | No Hit | |||
| BRD4_HUMAN | 1.46 | -0.20 | 1.86 | n/a | n/a | |||
| SOX4_HUMAN | 1.64 | -0.03 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, ldl cholesterol, ldl cholesterol change with statins, total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood