rs9960429 chr18:12057810 G>C
- Sequence
gatctgataaactctgcaaggggc[G/C]ctgcgcttaccaccaccaaccaca
- ASB in cell types
- bipolar neuron IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 2.11 | -2.00 | 1.17 | |||
| IPSC-derived bipolar neuron | 1.88 | -0.42 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Vagina, Whole_Blood