rs9962656 chr18:63180029 C>A
- Sequence
gaaagacctcagagccccaagtta[C/A]aaaagcacatggccatctacgcaa
- ASB in cell types
- MSC (mesenchymal stem cells)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 2.33 | -2.17 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, alcohol dependence symptoms, bipolar disorder, diastolic blood pressure (dbp), hdl cholesterol, hip bone mineral density (bmd), obesity with early age of onset (age >2), spine bone mineral density (bmd), systolic blood pressure (sbp), tetrology of fallot, transmission distortion