rs996286 chr12:88947586 G>T
- Sequence
tgcagacttctaaaactattcaag[G/T]ttattgacacacacagatgaatac
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 2.46 | -4.69 | 1.90 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, coronary artery disease (cad), hdl cholesterol change with statins, obesity with early age of onset (age >2)