rs9973027 chr18:9055572 A>C
- Sequence
tagttccttagactatttcttcat[A/C]atagctttcttctgcaaagtaatc
- ASB in cell types
- bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 2.05 | -1.51 | 1.00 |
Items per page:
1 – 1 of 1