rs9991125 chr4:185597748 G>A
- Sequence
ctcaaatggcaagtcgcttaagca[G/A]agatttgtaatgcagctgcactct
- ASB in cell types
- HepG2 (hepatoblastoma) WA01 (H1, human embryonic stem cells) GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.34 | 0.76 | 1.21 | |||
| WA01 (H1, human embryonic stem cells) | 1.30 | 0.47 | 1.11 | |||
| GBM39 (Human brain tumor) | 0.90 | -3.45 | 2.00 |
Items per page:
1 – 3 of 3