rs10000192 chr4:73759808 G>A
- Sequence
atgagaaacacctacacttcccca[G/A]tttttaaaatgtttaaaaaattcc
- ASB in cell types
- monocyte-derived macrophages
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.98 | 2.18 | 2.50 | 1.08 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
