rs10012 chr2:38075247 G>C
- Sequence
caaacgggcccgggggcgcggacc[G/C]gagctgccgcctccgttgcctcag
- ASB in cell types
- CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD14+ monocytes | 1.63 | n/a | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid