rs10017353 chr4:176425313 G>A
- Sequence
aatacaaattcagattataagaaa[G/A]ggttacactgacttccacaatgat
- ASB in cell types
- SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | -1.66 | 1.67 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), triglycerides, triglycerides change with statins, urinary albumin-to-creatinine ratio, variant creutzfeldt-jakob disease, waist hip ratio