rs10039983 chr5:40679687 C>T
- Sequence
aaagcaccggggcttcccagggtc[C/T]cctccgagttcccactccgcacct
- ASB in cell types
- L1236 (Hodgkin lymphoma) HAEC (human aortic endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| L1236 (Hodgkin lymphoma) | 0.11 | 1.78 | 2.00 | |||
| HAEC (human aortic endothelial cells) | n/a | 2.02 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg