rs1006698 chr9:2725283 A>C
- Sequence
aatatacagatgagggttgttatt[A/C]tcctgaaggtagtcacccatgacc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- ATF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF2_HUMAN | 1.70 | n/a | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease (age of onset), high platelet reactivity in patients with type 2 diabetes during acetylsalicylic acid (asa) treatment (defined as cepi-ct score of <193 s)