rs100876 chr11:34685486 G>A
- Sequence
ggcagggactctcgggtagatgca[G/A]cgctgactgggtgcccccgggaag
- ASB in cell types
- HT29 (colon adenocarcinoma) 786-O (renal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HT29 (colon adenocarcinoma) | -0.68 | 1.31 | 3.00 | |||
| 786-O (renal carcinoma) | 1.65 | -0.53 | 1.50 |
Items per page:
1 – 2 of 2