rs1009181 chr6:26158765 T>C
- Sequence
gtactagaaattgagtgctatggg[T/C]acgtattagatcgttagctcattt
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.17 | 0.60 | 2.00 | |||
| GM12878 (female B-cells) | 0.38 | 0.60 | 1.35 | |||
| A549 (lung carcinoma) | 0.18 | 0.68 | 1.11 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP college completion, coronary artery disease (cad), educational attainment, height, myopia, sporadic creutzfeldt-jakob disease, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood