rs10095165 chr8:124804196 C>G
- Sequence
aaatttatgttccagaactccttg[C/G]gggatcaagtggaactgtttagag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.69 | -0.07 | 1.54 | |||
| K562 (myelogenous leukemia) | -0.21 | 0.49 | 2.00 |
Items per page:
1 – 2 of 2