rs10103442 chr8:19209523 C>G
- Sequence
gagaagcttctgttgaggtttcat[C/G]tgtcaaaatgttgcttcgttccta
- ASB in cell types
- A549 (lung carcinoma) CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.33 | 0.81 | 1.95 | |||
| CD14+ monocytes | 0.94 | -3.08 | 2.50 |
Items per page:
1 – 2 of 2