rs10105292 chr8:18141143 G>A
- Sequence
gctggtttcactttgcggcaccaa[G/A]catttatccctagaacatttttat
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- Z280A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| Z280A_HUMAN | n/a | 2.52 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, height, major depressive disorder (narrow definition) (females), obesity with early age of onset (age >2), waist hip ratio