rs1011815 chr4:113436130 A>G
- Sequence
ggatgagtcattgcttttggcctc[A/G]ttaatgtggtggagctcttccgtc
- ASB in cell types
- HAEC (human aortic endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HAEC (human aortic endothelial cells) | 2.01 | -1.84 | 2.00 |
Items per page:
1 – 1 of 1