rs10125534 chr9:87510214 T>G
- Sequence
ttgacacgtatggagcagacaggg[T/G]aatgtcagcctcgtggccatggag
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts CD34+ bone marrow cell-derived erythroid progenitors
- ASB for transcription factors
- TAL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 1.41 | -0.17 | 1.60 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol change with statins, height, homa-b, paternal transmission distortion, thyrotoxic hypokalemic periodic paralysis in male patients with graves disease, transmission distortion
GTEx eQTL Muscle_Skeletal, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood