rs1012901 chr22:35600629 C>A
- Sequence
agaggctccgcgcctcggagcgga[C/A]gctcgttgtttttgaggaaccgat
- ASB in cell types
- periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | -2.00 | 1.51 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Thyroid