rs1013406 chr10:15419571 G>A
- Sequence
aaactggaaatcattaaactgcca[G/A]ttggcatagacagtaggaaagctg
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte hASC (preadipocytes) B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.13 | 0.55 | 1.95 | |||
| foreskin keratinocyte | 2.53 | n/a | 2.33 | |||
| hASC (preadipocytes) | -1.37 | 1.60 | 1.00 | |||
| B-cells | 1.79 | n/a | 2.00 |
Items per page:
1 – 4 of 4