rs10135277 chr14:35354025 C>T
- Sequence
tcctttgaccctgccattccagtt[C/T]taccctgcaggtacatcccacatg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) VCaP (prostate carcinoma) upper lobe of left lung transverse colon
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.72 | 0.41 | 1.51 | |||
| VCaP (prostate carcinoma) | 1.16 | -0.11 | 2.00 | |||
| upper lobe of left lung | -0.66 | 1.25 | 1.00 | |||
| transverse colon | 1.47 | -0.16 | 1.00 | |||
| A549 (lung carcinoma) | -0.10 | 0.65 | 2.10 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, height, ldl cholesterol change with statins, rheumatoid arthritis, schizophrenia, systolic blood pressure (sbp), total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood