rs10137714 chr14:34464061 A>G
- Sequence
atgtggctggagcaaaaagaatgt[A/G]tatgcagtagcaagagatgggcct
- ASB in cell types
- GM12878 (female B-cells) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 1.83 | -1.77 | 1.50 | |||
| HepG2 (hepatoblastoma) | 0.64 | -0.11 | 1.72 |
Items per page:
1 – 2 of 2