rs10158080 chr1:31509520 T>C
- Sequence
tactcctgcttcagacgcccactg[T/C]cccagctctgcctccaggccccag
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.37 | 0.49 | 1.36 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid, Whole_Blood