rs10158855 chr1:151543178 T>G
- Sequence
tgcagcaggtacaaggagccagtg[T/G]ttttcagaactgcagaccataacc
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.70 | -0.36 | 2.02 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.12 | 0.61 | 2.38 |
Items per page:
1 – 2 of 2