rs1016688 chr14:92793086 G>A
- Sequence
gatgcactgcagtcgcatggcaac[G/A]ggcgatgatgtgtaatccttaact
- ASB for transcription factors
- RFX5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX5_HUMAN | -2.47 | 2.24 | 1.50 | 3.16 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis