rs10181807 chr2:234688247 T>C
- Sequence
tgccaccatatcaccacatcatta[T/C]gccaccatgccacgataccaccat
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.22 | 1.01 | 1.99 | |||
| HEK293 (embryonic kidney) | 0.30 | 0.50 | 1.27 |
Items per page:
1 – 2 of 2