rs10211067 chr2:98087196 G>T
- Sequence
cgcgggtcacagagacctagaaca[G/T]ctggaatccttcgcccccggcgcg
- ASB in cell types
- HEK293 (embryonic kidney) ZR-75-1 (invasive ductal carcinoma)
- ASB for transcription factors
- ZBT26_HUMAN ZIC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZBT26_HUMAN | 0.81 | -0.81 | 1.00 | n/a | n/a | |||
| ZIC2_HUMAN | 1.94 | -1.84 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, college completion, diastolic blood pressure (dbp), ldl cholesterol change with statins, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp), years of education
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid