rs1022826 chr13:24097312 C>G
- Sequence
ggctgggtgcttacaaatgagaag[C/G]taaataatttccccaaggtcatgc
- ASB in cell types
- coronary artery smooth muscle
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| coronary artery smooth muscle | 1.31 | -0.87 | 1.33 |
Items per page:
1 – 1 of 1