rs10249476 chr7:128236973 G>T
- Sequence
ttttctctgtgtagccacttagct[G/T]cctgtgctgatacttgctgctggc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.32 | 0.65 | 1.53 | |||
| HEK293 (embryonic kidney) | -0.18 | 0.54 | 1.99 |
Items per page:
1 – 2 of 2