rs10261632 chr7:11344095 C>T
- Sequence
aattgggcacggtgtcgcttgaaa[C/T]agaaattcctcctttcatcacagt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- CEBPG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPG_HUMAN | -1.86 | 2.10 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, barnes akathisia rating scale, diastolic blood pressure (dbp), simpson-angus scale, systolic blood pressure (sbp)