rs10270627 chr7:70736829 G>T
- Sequence
cacaaagtgcatctctgcctgtta[G/T]aaggatccagacatagcgtagacg
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.67 | 0.11 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), diabetic retinopathy in type 2 diabetes mellitus, eye color, neuroticism, salmonella-induced pyroptosis, suicide attempts in major depressive disorder