rs10272973 chr7:47601996 G>A
- Sequence
gcaaagttcaccttgttagaagtt[G/A]acaccccccacctgctcctgtgca
- ASB in cell types
- A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.62 | -0.20 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, fasting blood glucose, ldl cholesterol, obesity with early age of onset (age >2), prop taste detection threshold, salmonella-induced pyroptosis, tardive dyskinesia, variant creutzfeldt-jakob disease