rs1028477 chr6:24961163 G>A
- Sequence
agccacataaaaaagacaagttat[G/A]atacaagacaggatatgaccagtg
- ASB in cell types
- LNCaP (prostate carcinoma) HEK293 (embryonic kidney) embryonic kidney
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 0.30 | 0.69 | 1.47 | |||
| HEK293 (embryonic kidney) | 2.30 | n/a | 3.00 | |||
| embryonic kidney | 2.27 | -1.04 | 3.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Nerve_Tibial