rs1036429 chr12:95877650 T>C
- Sequence
actttaaagggaccctcaactgaa[T/C]gaagaataataagtcaatccctgc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.79 | 0.01 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, decrease in fev1 (in asthmatic participants), diastolic blood pressure (dbp), ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1) percent change (in asthmatic participants), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), in ever smokers, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), in nonsmokers (never smokers), neuroblastoma (brain cancer)
PheWAS abnormal heart sounds, acute cystitis, adverse effects of antilipemic and antiarteriosclerotic drugs, anisometropia, bacterial enteritis, bacterial infection nos, benign mammary dysplasias, breast disorder nos, cardiomegaly, cholangitis, claw toe, complex regional/central pain syndrome, congenital cataract and lens anomalies, constipation, develomental delays and disorders, diseases of nail, diseases of respiratory system, diseases of sebaceous glands, diseases of white blood cells, epiphora, erectile dysfunction, esophageal atresia/tracheoesophageal fistula, exostosis of jaw, fracture of hand or wrist, fracture of unspecified bones, gastritis and duodenitis, gingivitis, gross hematuria, hallucinations, heart transplant/surgery, intestinal infection, intestinal infection due to c. difficile, light-headedness and vertigo, macular degeneration, dry, osteochondropathies, other diseases of the teeth and supporting structures, other disorders of eye, other specified diseases of nail, other specified peripheral vascular diseases, paroxysmal ventricular tachycardia, pathological, developmental or recurrent dislocation, periostitis, peripheral or central vertigo, pulmonary congestion and hypostasis, respiratory complications, sebaceous cyst, spondylolisthesis, congenital, sprains and strains, symptoms involving respiratory system, testicular dysfunction, testicular hypofunction, urinary obstruction, vertiginous syndromes and other disorders of vestibular system
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Liver, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid