rs1036938 chr15:78944905 C>G
- Sequence
ctctgcgtacctaaggagttcacg[C/G]acagttcggcggcaccgcagacgg
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.79 | -0.06 | 1.75 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.39 | 0.74 | 1.46 | |||
| GM12878 (female B-cells) | -1.50 | 1.67 | 1.33 | |||
| HepG2 (hepatoblastoma) | 0.57 | 0.45 | 1.25 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP college completion, coronary artery disease (cad), cystatin c in serum, hdl cholesterol, systolic blood pressure (sbp), total cholesterol, triglycerides
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Pancreas, Spleen, Testis, Thyroid, Whole_Blood