rs10398 chr11:308180 A>G
- Sequence
gagaaccatcccggtaacccgatc[A/G]ccgctggtcaccatgaaccacatt
- ASB in cell types
- GM12878 (female B-cells) tibial nerve upper lobe of left lung renal cortex
- ASB for transcription factors
- FOXK2_HUMAN SIX2_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 2.90 | -3.32 | 1.33 | n/a | n/a | |||
| SIX2_HUMAN | 1.64 | -0.93 | 1.50 | -1.44 | Weak Concordant | |||
| EP300_HUMAN | -0.25 | 2.31 | 1.67 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP asthma, infant head circumference, irritible bowel syndrome, rheumatoid arthritis, serum creatinine
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood