rs10407023 chr19:3683930 C>T
- Sequence
tcccctcccgggcagtcccacacc[C/T]cccccacgctggagcccccgcttc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- EGR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EGR1_HUMAN | -3.84 | 2.23 | 2.50 | 4.74 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Muscle_Skeletal, Spleen