rs10416946 chr19:54047863 T>C
- Sequence
tgtccacagatcctggccaaatgt[T/C]gcatcagtatttgcaaattgccag
- ASB in cell types
- mesenchymal stem cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| mesenchymal stem cells | 1.38 | -0.89 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood