rs1042486 chr9:124021154 G>C
- Sequence
cctggaccgtgaccagccataccc[G/C]agcagccagaagaccaagcgcatg
- ASB in cell types
- HepG2 (hepatoblastoma) mammary epithelial cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.91 | 0.29 | 1.33 | |||
| mammary epithelial cells | -2.14 | 1.93 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, fasting insulin, homa-b, homa-ir, mitral annular calcium, rheumatoid arthritis