rs10426377 chr19:48588977 C>A
- Sequence
gtgcagggccgcgtgggcccggtg[C/A]ggacttgagctctgaccgagtgac
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma)
- ASB for transcription factors
- SMC3_HUMAN RAD21_HUMAN ZN623_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 0.28 | 0.85 | 1.46 | n/a | n/a | |||
| RAD21_HUMAN | 0.80 | 0.45 | 1.49 | n/a | n/a | |||
| ZN623_HUMAN | 0.28 | n/a | 1.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP hip osteoarthritis, hip osteoarthritis (females), hip osteoarthritis (males), infant head circumference, knee osteoarthritis, knee osteoarthritis (females), maternal transmission distortion, osteoarthritis (females), osteoarthritis (males), serum creatinine, sporadic creutzfeldt-jakob disease, tetrology of fallot